[example]Skip example

     

  • Size: 983 kb
  • Date: 2009-09-23
  • .wav
  • www.audiography.com.au

http://www.audiography.com.au/images/[EXAMPLE]Skip Example.wav

XHTML example by example

     

  • Size: 40.1 mb
  • .pdf
  • eMule

example

     ...N EXAMPLE OF A SELECTION PLAN FOR A SCHOOL RESOURCE CENTRE This is an example of how a selection plan for a school library might be framed All learning resources for use by students and staff at NAME OF SCHOOL are selected in accordance with this plan approved by the Learning Resources Selection...

  • Size: 37.5 kb
  • Date: 2012-05-07
  • .doc
  • education.qld.gov.au

http://education.qld.gov.au/library/docs/example.doc

example

     class titleCache protectedTitleCache title e9f8cdb7 6819 44e8 95d3 e2d0690c3523 class title e9f8cdb7 6819 44e8 95d3 e2d0690c3523 text title e9f8cdb7 6819 44e8 95d3 e2d0690c3523 language artist mediaCreated rights 0 class rights 0 type rights 0 agent rights 0 text Types of media object Title Preserve Title Full Title Text type Full Title Text Full T...

  • Size: 18.5 kb
  • Date: 2012-01-13
  • .xls
  • scratchpad.cate-araceae.org

...d.cate-araceae.org/sites/scratchpad.cate-araceae.org/files/example.xls

example

     ...Name License Address1 Address2 City State ZipCode Phone Fax PrimarySpecialty Example Test C M D X 4321 2100 Riverfront Drive Little Rock Arkansas 72202 501 296 1802 501 296 1805 Gastroenterology Public John Q M D Q1951A 123 Some Street Apartment J Some Town Arkansas 71111 1243 555 555 5555 Physical...

  • Size: 1.7 kb
  • Date: 2012-01-11
  • .txt
  • www.armedicalboard.org

http://www.armedicalboard.org/example.txt

example

     [ see an example output ] leeloo oping c4 faui2k3 org noris net PING faui2k3 org 2001 780 106 1 56 bytes of data PING noris net 62 128 1 30 56 bytes of data 56 bytes from faui2k3 org 2001 780 106 1 icmp seq 1 ttl 60 time 52 46 ms 56 bytes from noris net 62 128 1 30 icmp seq 1 ttl 59 time 46 97 ms 56 bytes from faui2k3 org 2001 780 106 1 icmp seq 2 ttl 60 time 53 06 ms 56 by...

  • Size: 1 kb
  • Date: 2012-01-07
  • .txt
  • verplant.org

http://verplant.org/liboping/example.txt

example

     ET ECHO ON ALTER SYSTEM FLUSH SHARED POOL pause ALTER SYSTEM FLUSH BUFFER CACHE pause DROP TABLE my indexes pause DROP TABLE my tables pause CREATE TABLE my tables AS SELECT dba tables FROM dba tables pause CREATE TABLE my indexes AS SELECT dba indexes FROM dba tables dba indexes WHERE dba tables owner dba indexes table owner AND dba tables table n...

  • Size: 10.9 kb
  • Date: 2012-01-07
  • .txt
  • nocoug.org

http://nocoug.org/download/2008-11/Example.txt

example

     nput DNA Sequence ATGTCTATCACTAAAGATCAAATCATTGAAGCAGTTGCAGCTATGTCTGTAATGGACGTTGTAGAACTGATCTCTGCAAT GGAAGAAAAATTCGGTGTTTCCGCTGCTGCTGCTGTAGCTGTAGCTGCTGGCCCGGTTGAAGCTGCTGAAGAAAAAACTG AATTCGACGTAATTCTGAAAGCTGCTGGCGCTAACAAAGTTGCTGTTATCAAAGCAGTACGTGGCGCAACTGGCCTGGGT CTGAAAGAAGCTAAAGACCTGGTAGAATCTGCACCGGCTGCTCTGAAAGAAGGCGTGAGCAAAGACGACGCAGAAGCACT GAAAAAAG...

  • Size: 58 kb
  • Date: 2012-01-04
  • .txt
  • www-bioinf.uni-regensburg.de

http://www-bioinf.uni-regensburg.de/gcb4gene/example.txt

example

     unning on rhsbio1 Inifile Verbose 0 Inifile Max loops for optimizing 5 Inifile Max length for reference genes 9600 bases Inifile Min gene length 300 bases Inifile Searching for reference genes with annotation ribosomal and protein Reading sequence from file home zeh21362 codonbias FM209186 gbk Organism Pseudomonas aeruginosa LESB58 complete genome ...

  • Size: 407.8 kb
  • Date: 2012-01-07
  • .txt
  • www-bioinf.uni-regensburg.de

http://www-bioinf.uni-regensburg.de/gcb4genome/example.txt

example

     package Data is Two array types type Row is array of integer type Matrix is array of Row Global data Table Row 100 end procedure test1 Bound Integer is Result Row 100 begin Compute first few Fibonacci numbers with 32 bit integers computation will overflow much before 100 Result 0 1 Result 1 1 for J in 2 Bound loop Result J Result J 1 Result J 2 exi...

  • Size: 1 kb
  • Date: 2012-01-07
  • .txt
  • www.cs.nyu.edu

http://www.cs.nyu.edu/courses/spring04/G22.2130-001/example.txt

1 2 3 4 5 6 7 8 9 10 >>